Journal: Science immunology

Article Title: ATR-mediated CD47 and PD-L1 upregulation restricts radiotherapy-induced immune priming and abscopal responses in colorectal cancer

doi: 10.1126/sciimmunol.abl9330

Figure Lengend Snippet: Mean fluorescent intensity (MFI) of CD47 and PD-L1 on HCT116 cells (A) 48 hours after photon (8 Gy) or proton (8 CGE) irradiation, (B) 48 hours after 4–20 Gy or sham irradiation and (C) 2–6 days after 8-Gy or sham irradiation determined via flow cytometry (n = 3–4). D-F, Histoscores (H-scores; D and F) and (E) representative images of CD47 immunohistochemistry surface staining on CRC cells (arrowheads) in pretreatment biopsies versus post-irradiation surgical specimens in 30 rectal cancer patients who underwent short-course neoadjuvant radiotherapy (RT, 5 Gy × 5 Fr) followed by en-bloc resection. Bars on H-scores, mean ± standard errors (paired t-test); good responders, Mandard tumor regression grade (TRG) 2–3; poor responders, TRG 4–5; scale bar, 100 μm. G, CD47 and PD-L1 MFI in various human solid cancer cells after 8-Gy irradiation (n = 6). H-J, Expression of CD47 and PD-L1 on scrambled shRNA control (shCtrl) versus ATR shRNA-knockdown (shATR) HCT116 cells treated +/− 8 Gy radiotherapy. ATR knockdown was assessed by (H) immunoblotting 24 hours after 8-Gy or sham irradiation (n = 3 biological replicates). I, Transcriptional levels of CD47 in shCtrl or shATR clones 24 hours after 8-Gy or sham irradiation (n = 9). J, Histograms and MFI of CD47 and PD-L1 on shCtrl- or shATR-HCT116 cells 48 hours after 8-Gy or sham irradiation (n = 5). K-M, Histograms and MFI of CD47 and PD-L1 on HCT116 cells 48 hours after 8-Gy or sham irradiation +/− (K) ATRi (300 nM VE822), (L) Chk1i (300 nM UCN-01), or (M) STAT3i (100 μM NSC74859; n = 5–6). N, Phagocytosis assays using differentiated THP1-Dual cells, which expresses IRF and NF-κB reporters, co-cultured with CFSE-labeled HCT116 cells +/− RT and ATR inhibition (300 nM VE822, n = 6–9). Phagocytosis is expressed as the percentage of CFSE+ cells in CD64+ THP1-Dual cells. *P <0.05, **P <0.01, ***P <0.001, ****P <0.0001.

Article Snippet: HCT116 and HT29 cells were lentivirally transduced with mCherry-shATR (target sequences: GGAATATAATACAGTTGTACA, GCGGCTTAAGTCTGATTTGCT, and GCCATTATCAAAGCTGATAAA) or mCherry-scrambled shRNA vectors, whereas MC38 cells were transduced with mCherry-Luciferase lentiviral particles according to manufacturer’s protocols (GeneCopoeia).

Techniques: Irradiation, Flow Cytometry, Immunohistochemistry, Staining, Expressing, shRNA, Control, Knockdown, Western Blot, Clone Assay, Cell Culture, Labeling, Inhibition

Journal: Nature Communications

Article Title: ORC1 binds to cis -transcribed RNAs for efficient activation of replication origins

doi: 10.1038/s41467-023-40105-3

Figure Lengend Snippet: a Schematic representation of human ORC1 protein domains , , . b Cross-correlation between endogenous ORC1, and unlabeled (control) or EU-labeled RNA (short or long pulse), comparing STORM experimental (EXP) and randomized (RND) analysis in the chromatin fraction of U2OS cells synchronized in G1. Data were presented as mean values ( n > 50 cells). Indicated p values (ns denoting p value >0.05) derive from unpaired two-sample t -test. c Schematic of RIP-seq and iCLIP experimental approaches, where endogenous or Flag-tagged ORC1 is immunoprecipitated from native or UV-crosslinked nuclear extracts, followed by recovery of full-length or digested bound RNAs. Below, the number of genes identified by both methods, with different iCLIP stringencies, and hypergeometric test p values of the experimental overlap (RIP-iCLIP) on top of the bars; red for selected high confidence (HC) ORC1-RNAs. d Genomic distributions of ORC1 iCLIP crosslinks, and (below) their density around TSSs (−/+ 10 kb) of ORC1-bound genes. e Gene length and expression level of high confidence (HC) ORC1-RNAs (iCLIP-RIP overlap) and ORC1-RNAs (iCLIP-RIP union), relative to sample size-matched control genes with different fold changes (FC) in ORC1 RIP-seq. n = number of genes in each category (Supplementary Data ; from iCLIP data [>5 crosslink sites and <0.05 FDR] and RIP-seq data [log2 fold change >1 and p value <0.05]). Box plots show the median distribution between Q1 and Q3. *** denotes p value <0.001, derived from unpaired two-tailed Student’s t -test. f Gene biotypes of ORC1-RNAs. g Percentage of ORC1-RNA and high confidence ORC1-RNA (HC) genes with mutual interactions according to Hi-C analysis, compared to controls shown in Fig. 1e. Bars represent mean values. **** denotes p value <0.0001, derived from a two-proportion z -test. h , i Density plots of h ORC1 ChIP-seq and i SNS-seq normalized reads across six quantiles (Q) of ORC1-RNA genes, defined by ORC1 iCLIP, centered around their TSSs (−/+ 5 kb). j Browser snapshot of representative high confidence ORC1-RNA genes, showing data of ORC1 RNA-binding (ORC1 RIP-seq or iCLIP crosslinks), and replication origins (SNS-seq) at their TSSs, in HCT116 cells. Green arrows indicate positions of GAA repeats.

Article Snippet: Samples were de-crosslinked overnight at 65 °C, followed by phenol:chloroform DNA extraction and ethanol precipitation. qPCR of precipitated DNA was done as cDNA samples (see RNA processing section), with self-designed primers at genomic DNA replication origins or control regions (Supplementary Data ), having SNS-seq data in wild-type HCT116 cells as a reference and purchased from Metabion.

Techniques: Labeling, Immunoprecipitation, Expressing, Derivative Assay, Two Tailed Test, Hi-C, ChIP-sequencing, RNA Binding Assay

Journal: Nature Communications

Article Title: ORC1 binds to cis -transcribed RNAs for efficient activation of replication origins

doi: 10.1038/s41467-023-40105-3

Figure Lengend Snippet: a RNA-FISH representative images, and signal quantification (below), of RNAs containing GAA repeats, in ASO-transfected HCT116 cells. Dots represent mean values ( n = 4 biologically independent samples) ±SEM. * denotes p value < 0.05, derived from unpaired two-tailed Student’s t -test. b DNA fiber quantification of inter-origin distances and fork rates of ASO-transfected HCT116 cells. Red lines indicate the median. ns denotes p value > 0.05, ** denotes p value < 0.01, **** denotes p value <0.0001, derived from unpaired two-tailed Mann–Whitney t -test. c SNS-seq peak count frequency and distribution relative to TSS positions (±3 kb) in ASO control and anti-GAA treated HCT116 cells. d GSEA showing the reduction of SNS-seq signal (peaks enriched in the control condition) in anti-GAA downregulated genes. Statistical significance (adjusted p value 0.038) of the enrichment score (ES) derives from a permutation test. e CDC45 and PCNA chromatin immunofluorescences per cell (HCT116) upon ASO knockdown, after soluble protein washout. Data were presented as mean values ( n > 100 cells) ±SEM. *** denotes p value < 0.001, derived from unpaired two-tailed Mann–Whitney t -test. f ORC1 western blot and protein quantification, in chromatin extracts of ASO-transfected HCT116 cells. Data were presented as mean values ( n = 5 biologically independent experiments) ±SEM. ns denotes p value > 0.05, * denotes p value < 0.05, derived from paired two-tailed Student’s t -test. g Browser snapshot at DDX5-CEP95 locus showing ORC1 RIP-seq enrichment, ORC1 iCLIP peaks, and SNS-seq reads in HCT116 cells, with the position of qPCR primers (#) indicated, and origins highlighted in blue. h Enrichment of nascent strands determined by SNS-qPCR at genomic positions indicated in Fig. 2g, in siRNA-treated HCT116 cells. Data were presented as mean values ( n = 5 biologically independent experiments) ±SEM. ns denotes p value > 0.05, * denotes p value <0.05, ** denotes p value < 0.01, derived from paired two-tailed Student’s t -test.

Article Snippet: Samples were de-crosslinked overnight at 65 °C, followed by phenol:chloroform DNA extraction and ethanol precipitation. qPCR of precipitated DNA was done as cDNA samples (see RNA processing section), with self-designed primers at genomic DNA replication origins or control regions (Supplementary Data ), having SNS-seq data in wild-type HCT116 cells as a reference and purchased from Metabion.

Techniques: Transfection, Derivative Assay, Two Tailed Test, MANN-WHITNEY, Western Blot

Journal: Nature Communications

Article Title: ORC1 binds to cis -transcribed RNAs for efficient activation of replication origins

doi: 10.1038/s41467-023-40105-3

Figure Lengend Snippet: a 3D model of human ORC1 showing domains in colors, and residues R441, R444, and R465 (involved in RNA-binding) in red. Below, the vertebrate consensus of ORC1 RNA-binding region, circles indicating mutated residues in MUT-ORC1. b RNA staining of EMSA assays, with GST-tagged purified WT and MUT-ORC1 (amino acids 413–511) (2.5 µM) incubated with fragmented cellular RNA (2.5 µM). Below, the silver staining of proteins used in the assay. c Cross-correlation between ORC1 and EU-labeled RNA (long pulse) in G1-synchronized U2OS cells, untransfected or transfected with Halo-tagged WT and MUT-ORC1, comparing STORM experimental (EXP) and randomized (RND) samples. Data were presented as mean values ( n > 50 cells) ± SEM. ns denotes p value >0.05, ** denotes p value <0.01, derived from unpaired two-sample t -test. d DNA fiber quantification of inter-origin distances and fork rates in HCT116 cells transfected with the indicated siRNAs, ±plasmids expressing Flag-tagged WT or MUT-ORC1. Black lines indicate the median. ns denotes p value >0.05, * denotes p value <0.05, ** denotes p value <0.01, **** denotes p value <0.0001, derived from unpaired two-tailed Mann–Whitney t -test. e Browser snapshot at ORC1-RNA PABPC1 , NFAT5 , and DDX5-CEP95 loci, showing SNS-seq normalized signal of HCT116 cells stably expressing WT or MUT-ORC1. f GSEA showing enrichment of ORC1-RNAs in merged iCLIP-defined quantiles (Q), toward ranked genes according to their WT vs MUT (log2 fold change) SNS-seq coverage at TSSs. Statistical significance (adjusted p value 1.13e-18 or 0.003) of the enrichment scores (ES) were calculated by permutation tests. g CDC45 and PCNA chromatin immunofluorescences per cell, in HCT116 cells stably expressing WT or MUT-ORC1, after soluble protein washout. Data were presented as mean values ( n > 100 cells) ± SEM. *** denotes p value <0.001, derived from unpaired two-tailed Mann–Whitney t -test. h Coverage plot of CDC45 ChIP-seq data at TSSs, in WT or MUT-ORC1 HCT116 stably expressing cells, and two-tailed t -test statistical results between their coverage at TSSs of ORC1 iCLIP-defined gene quantiles (Q).

Article Snippet: Samples were de-crosslinked overnight at 65 °C, followed by phenol:chloroform DNA extraction and ethanol precipitation. qPCR of precipitated DNA was done as cDNA samples (see RNA processing section), with self-designed primers at genomic DNA replication origins or control regions (Supplementary Data ), having SNS-seq data in wild-type HCT116 cells as a reference and purchased from Metabion.

Techniques: RNA Binding Assay, Staining, Purification, Incubation, Silver Staining, Labeling, Transfection, Derivative Assay, Expressing, Two Tailed Test, MANN-WHITNEY, Stable Transfection, ChIP-sequencing

Journal: Nature Communications

Article Title: ORC1 binds to cis -transcribed RNAs for efficient activation of replication origins

doi: 10.1038/s41467-023-40105-3

Figure Lengend Snippet: a p53 and ORC1-3xFlag protein quantification from western blots with total extracts of HCT116 cells, transfected with WT or MUT-ORC1, and treated with cycloheximide (CHX) or MG-132. Dots represent mean values ( n = 3 biologically independent experiments) ± SEM. ns denotes p value >0.05, * denotes p value <0.05, ** denotes p value <0.01, derived from paired two-tailed Student’s t -test. b Western blot on chromatin extracts of HCT116 cells, transfected with Flag-tagged WT-ORC1 and MUT-ORC1, unsynchronized (Uns) or synchronized in G1/S and released at different times (T as in Supplementary Fig. ). Below, normalized protein quantification. Dots represent mean values ( n = 4 biologically independent experiments) ± SEM. ns denotes p value >0.05, * denotes p value <0.05, derived from paired two-tailed Student’s t -test. c Western blot and quantification of endogenous ORC1 on chromatin in different stages of the cell cycle (T as in Supplementary Fig. ), upon depletion of GAA-RNAs (ASO anti-GAA) or control conditions (ASO CTRL). Bars represent mean values ( n = 3 biologically independent experiments) ± SEM. ns denotes p value >0.05, * denotes p value <0.05, ** denotes p value <0.01, derived from paired two-tailed Student’s t -test. d Western blot showing the effect of RNase A treatment on WT and MUT-ORC1 chromatin association, along the cell cycle of synchronized cells (T as in Supplementary Fig. ). Quantification of independent biological replicates ( n = 4) is shown in Supplementary Fig. . e Representation of the IDR in WT and MUT-ORC1, showing RNA-binding regions (orange), and the discrete positions of RNA-binding mutations (black) and phosphorylated residues (red) detected by mass spectrometry, in control or GAA-knockdown conditions. Source data are provided as a Source Data file.

Article Snippet: Samples were de-crosslinked overnight at 65 °C, followed by phenol:chloroform DNA extraction and ethanol precipitation. qPCR of precipitated DNA was done as cDNA samples (see RNA processing section), with self-designed primers at genomic DNA replication origins or control regions (Supplementary Data ), having SNS-seq data in wild-type HCT116 cells as a reference and purchased from Metabion.

Techniques: Western Blot, Transfection, Derivative Assay, Two Tailed Test, RNA Binding Assay, Mass Spectrometry